Build a CRISPR library

Start with the biological resolution you need: a vector-aware pegRNA pool for variant-level Prime Editing MAVE, or published sgRNAs for gene-level CRISPR screening.

CRISPR library workflows

Build a Prime Editing MAVE library

GRCh38 · PE2-style · pegRNA abundance

This workflow designs pegRNAs for human GRCh38 SNVs. PRIDICT2 ranks candidates and pegLIT engineers their linkers; neither measures editing efficiency. Screen analysis uses pegRNA abundance, not sensor or endogenous editing. Methods and sources.

CSV/TSV: chrom, pos, ref, alt are required; variant_id and gene are optional. The position is a 1-based GRCh38 genomic coordinate. VCF: CHROM, POS, ID, REF, ALT. This version supports human GRCh38 SNVs.
Download example
Pasted records receive the same strict GRCh38 REF validation as uploaded files.
Choose 0–500. These are published non-targeting epegRNA spacer/PBS/RTT components from Addgene StopPR #227706, re-engineered through the same #255532 scaffold and fixed-seed pegLIT workflow as your variants. They are exported as NON_TARGETING, not assigned to a variant.
sgOpti-tevoPQ1 — Prime Editing guide vector 5′ LTR psi+ / RRE hU6 variable PE insert tevopreQ1 + 7T EF-1α PuroR WPRE 3′LTR Spacer → optimized 86-nt scaffold → RTT → PBS → pegLIT linker The BsmBI/Esp3I-generated insert ends before vector-encoded tevopreQ1 → 7T.
Lentiviral Prime Editing transfer vector. The variable PE cassette is assembled after hU6; tevopreQ1 and the 7T terminator remain vector encoded. The deposited #255532 annotation places an EF-1α core promoter directly upstream of PuroR.
Checking sgOpti-tevoPQ1 #255532 source sequence…

Prime Editing MAVE vector architecture and cloning walkthrough

#255532 only

This is the variant-level branch of the same six-step CRISPR library workflow shown below. It preserves the distinct pegRNA cassette, full-identity QC layout, and validated #255532 junctions.

1. Linearize the vector

Digest sgOpti-tevoPQ1 with BsmBI/Esp3I. The site checks the deposited #255532 sequence and calculates the retained junctions from its Type IIS cut sites.

2. Assemble the variable PE cassette

Each selected reagent is assembled as spacer → optimized 86-nt scaffold → RTT → PBS → pegLIT linker. The vector, not the insert, supplies tevopreQ1 and the downstream 7T terminator.

3. Use the PE-specific amplicon layout

Use the MAVE full-insert identity layout generated with this project. Standard KO/i/a shared sgRNA amplicon primers are not compatible with pegRNA identity and must not be selected for this workflow.

The full identity is required because different pegRNAs can share a spacer while differing in RTT or PBS.

hU6-F, 5′→3′: GAGGGCCTATTTCCCATGATT
Left 20 bp: TGTGGAAAGGACGAAACACC
Right 20 bp: CGCGGTTCTATCTAGTTACG

These 20 bp arms are hash-gated against the deposited #255532 sequence and are added to every generated cloning-ready oligo. No unverified universal PE reverse primer is substituted into the workflow.

sgOpti-tevoPQ1 feature map

Validated #255532 architecture: hU6 promoter / BsmBI-Esp3I variable insertion region / vector-encoded tevopreQ1 / 7T terminator / EF-1α core promoter / PuroR / lentiviral transfer elements. The variable insert is spacer / optimized scaffold / RTT / PBS / pegLIT linker.

Open official Addgene record and map

BsmBI/Esp3I digest: open the validated #255532 PE insertion region

Use the actual sgOpti-tevoPQ1 sequence, not a KO backbone. CRISPR Screen Guider verifies the 9,025 bp source hash and calculates the retained Type IIS junctions before it generates each vector-aware insert.

  • The vector provides tevopreQ1 and the downstream 7T terminator.
  • The synthesized variable insert must not contain a second tevopreQ1 motif.

Upload variants and run the design. Progress appears below; the time required depends on library size. Save the private job link provided after submission to return later. Download the pool when preparation finishes.

Upload variants or load example variants, then run the Prime Editing MAVE design.

Build a gene-level CRISPR library

Download protocol YAML

This standard CRISPR library module preserves published guide order. It does not design guides, compute new efficacy scores, or mix library sources. Targeting and non-targeting control spacers are both taken directly from the official Brunello release.

Up to 1,000 symbols. Unresolved symbols are returned explicitly; they are never substituted.
Choose 0–1,000. The first N non-targeting spacers are selected in their original Brunello source order; no random or newly designed NT sequences are used.

Standard sgRNA vector architecture and cloning walkthrough

Educational schematic, not to scale. The feature layouts follow the official lentiGuide-Puro and lentiCRISPR v2 records. Confirm the current deposited sequence and restriction sites before laboratory use.

lentiGuide-Puro — guide vectorU6sgRNAscaffoldEF1aPuroRWPRE5' LTR · psi+ · RREcPPT · 3' LTRRequires a pre-established compatible Cas9 or dCas9 cell line.
Guide-only lentiviral transfer vector. The sgRNA is inserted between the U6 promoter and scaffold.
lentiCRISPR v2 — one-vector Cas9 and guide systemU6sgRNAscaffoldEFSSpCas9 + FLAGP2APuroR5' LTR · psi+ · RREWPRE · cPPT · 3' LTRSpCas9 is expressed from EFS; the pooled sgRNA cassette remains U6 → sgRNA → scaffold.
One-vector knockout backbone. SpCas9, FLAG tag, P2A, and puromycin resistance are explicitly shown.

lentiGuide-Puro feature map

5' LTR / psi+ / RRE / U6 promoter / BsmBI guide-insertion cassette / EF1a / PuroR / WPRE / cPPT / 3' LTR. This is the guide-only option; establish a compatible Cas9 or dCas9 cell line first.

Open official Addgene record and map

lentiCRISPR v2 feature map

5' LTR / psi+ / RRE / U6 promoter / BsmBI guide-insertion cassette / EFS / SpCas9 / FLAG / P2A / PuroR / WPRE / cPPT / 3' LTR. This one-vector option is used here only for knockout libraries.

Open official Addgene record and map

BsmBI digest: open the guide cassette in its correct order

For either lentiGuide-Puro or lentiCRISPR v2, the guide insertion region is U6 promoter → BsmBI → removable stuffer cassette → BsmBI → sgRNA scaffold. Digest the verified backbone with BsmBI; retain the linearized backbone, not the released stuffer.

  • Reaction: the cited workflow uses 3 µg plasmid, 3 µL NEBuffer 3.1, 3 µL BsmBI and water to 30 µL, incubated at 55°C.
  • Checkpoint: use the current plasmid map to verify fragments before recovery.

Library-scale cloning and QC calculator

Enter your expected values. The calculator makes the coverage arithmetic explicit; confirm final conditions with the current vector record, competent-cell specification, and sequencing provider.